2012 ha taz addgene (Addgene inc)
Addgene inc is a verified supplier 
94
Structured Review
Addgene inc
2012 ha taz addgene
2012 Ha Taz Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 29 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/2012+ha+taz+addgene/HA-TAZ+(Plasmid+%2332839)/pm30472188-277-62-64
Average 94 stars, based on 29 article reviews
2012 Ha Taz Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 29 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/2012+ha+taz+addgene/HA-TAZ+(Plasmid+%2332839)/pm30472188-277-62-64
Average 94 stars, based on 29 article reviews
2012 ha taz addgene - by Bioz Stars,
2026-10
94/100 stars
Images
Related Articles
Sequencing:Article Title: OTUB2 Promotes Cancer Metastasis via Hippo-Independent Activation of YAP and TAZ. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Human Insulin Sino Biological Cat# 11038-HNAY Dabrafenib Medchem Express Cat# HY-141660 LY3214996 Medchem Express Cat# HY-101494 Trametinib DMSO solvate Medchem Express Cat# HY-10999A Protease inhibitor cocktail Roche Cat# 04693159001 Phosphatase inhibitor cocktail Roche Cat# 04906837001 Critical Commercial Assays Dual-Luciferase Reporter Assay System Promega Cat# E1910 RevertAid First Strand cDNA Synthesis Kit Fermentas Cat# K1622 SYBR Green Master Mix Applied Biosystems Cat# A25742 StepOne Plus real-time PCR system Applied Biosystems Cat# 4376600 Duolink In Situ Detection Reagents Red Sigma-Aldrich Cat# DUO92008 Duolink In Situ PLA Probe Anti-Mouse PLUS Sigma-Aldrich Cat# DUO92001 Duolink In Situ PLA Probe Anti-Rabbit MINUS Sigma-Aldrich Cat# DUO92005 Deposited Data Raw imaging data This paper; Mendeley Data https://data.mendeley.com/datasets/h8jrmjjjbh/1 NKI295 dataset the Netherlands Cancer Institute http://ccb.nki.nl/data/ GSEA datasets Broad Institute http://software.broadinstitute.org/gsea/login. jsp;jsessionid=C2668366EB0BAA1232425637 E84322E2 Experimental Models: Cell Lines HEK293T, HEK293A, HeLa, 4T1, 4T07 and MDA-MB-231 cell lines ATCC Zhang et al., 2017b MCF10A (MI) and MCF10A-RAS (MII) cell lines Dr. Fred Miller, Barbara Ann Karmanos Cancer Institute, Detroit, USA N/A HEK293A LATS1/2 KO cells Dr. Kun-liang Guan, University of California San Diego, La Jolla, USA N/A Experimental Models: Organisms/Strains Mouse: Female BALB/c nude mice Model Animal Resource Information Platform, Nanjing, China N/A Mouse: Female syngeneic BALB/c mice Model Animal Resource Information Platform, Nanjing, China N/A Oligonucleotides See Table S6 for the List of Oligos for RT-qPCR This paper N/A shRNA targeting sequence: human OTUB2 (#1) Sigma-Aldrich TRCN0000230821 shRNA targeting sequence: human OTUB2 (#2) Sigma-Aldrich TRCN0000230819 shRNA targeting sequence: human YAP 30UTR Sigma-Aldrich TRCN0000300282 shRNA targeting sequence: human TAZ 30UTR Sigma-Aldrich TRCN0000019469 shRNA targeting sequence: mouse OTUB2 (#1) CCGGCTTCGGTTTATCTGCTCTATACTCGAGT ATAGAGCAGATAAACCGAAGTTTTTG This paper N/A shRNA targeting sequence: mouse OTUB2 (#2) CCGGCTATCCATTCTTCGGGATCATCTCGAGA TGATCCCGAAGAATGGATAGTTTTTG This paper N/A sgRNA targeting sequence: human OTUB2 (#1) CCGTGTCACATTTTTCTGAT This paper N/A (Continued on next page) Molecular Cell 73, 1–15.e1–e7, January 3, 2019 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER sgRNA targeting sequence: human OTUB2 (#2) CCGCTGAAAACAGGATTTAC This paper N/A sgRNA targeting sequence:mouse OTUB2 (#1) TGACTACTTTTGGGCCATGC This paper N/A sgRNA targeting sequence:mouse OTUB2 (#2) AGTGTTTCTCGGCTGCGTAA This paper N/A Recombinant DNA See Table S1 for the List for DUB cDNA library This paper N/A HA-SUMO1-3, SENPs and HA-PIAS1-3, Xa and Xb Zhang et al., 2017a; Zhang et al., Recombinant:Article Title: OTUB2 Promotes Cancer Metastasis via Hippo-Independent Activation of YAP and TAZ. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Human Insulin Sino Biological Cat# 11038-HNAY Dabrafenib Medchem Express Cat# HY-141660 LY3214996 Medchem Express Cat# HY-101494 Trametinib DMSO solvate Medchem Express Cat# HY-10999A Protease inhibitor cocktail Roche Cat# 04693159001 Phosphatase inhibitor cocktail Roche Cat# 04906837001 Critical Commercial Assays Dual-Luciferase Reporter Assay System Promega Cat# E1910 RevertAid First Strand cDNA Synthesis Kit Fermentas Cat# K1622 SYBR Green Master Mix Applied Biosystems Cat# A25742 StepOne Plus real-time PCR system Applied Biosystems Cat# 4376600 Duolink In Situ Detection Reagents Red Sigma-Aldrich Cat# DUO92008 Duolink In Situ PLA Probe Anti-Mouse PLUS Sigma-Aldrich Cat# DUO92001 Duolink In Situ PLA Probe Anti-Rabbit MINUS Sigma-Aldrich Cat# DUO92005 Deposited Data Raw imaging data This paper; Mendeley Data https://data.mendeley.com/datasets/h8jrmjjjbh/1 NKI295 dataset the Netherlands Cancer Institute http://ccb.nki.nl/data/ GSEA datasets Broad Institute http://software.broadinstitute.org/gsea/login. jsp;jsessionid=C2668366EB0BAA1232425637 E84322E2 Experimental Models: Cell Lines HEK293T, HEK293A, HeLa, 4T1, 4T07 and MDA-MB-231 cell lines ATCC Zhang et al., 2017b MCF10A (MI) and MCF10A-RAS (MII) cell lines Dr. Fred Miller, Barbara Ann Karmanos Cancer Institute, Detroit, USA N/A HEK293A LATS1/2 KO cells Dr. Kun-liang Guan, University of California San Diego, La Jolla, USA N/A Experimental Models: Organisms/Strains Mouse: Female BALB/c nude mice Model Animal Resource Information Platform, Nanjing, China N/A Mouse: Female syngeneic BALB/c mice Model Animal Resource Information Platform, Nanjing, China N/A Oligonucleotides See Table S6 for the List of Oligos for RT-qPCR This paper N/A shRNA targeting sequence: human OTUB2 (#1) Sigma-Aldrich TRCN0000230821 shRNA targeting sequence: human OTUB2 (#2) Sigma-Aldrich TRCN0000230819 shRNA targeting sequence: human YAP 30UTR Sigma-Aldrich TRCN0000300282 shRNA targeting sequence: human TAZ 30UTR Sigma-Aldrich TRCN0000019469 shRNA targeting sequence: mouse OTUB2 (#1) CCGGCTTCGGTTTATCTGCTCTATACTCGAGT ATAGAGCAGATAAACCGAAGTTTTTG This paper N/A shRNA targeting sequence: mouse OTUB2 (#2) CCGGCTATCCATTCTTCGGGATCATCTCGAGA TGATCCCGAAGAATGGATAGTTTTTG This paper N/A sgRNA targeting sequence: human OTUB2 (#1) CCGTGTCACATTTTTCTGAT This paper N/A (Continued on next page) Molecular Cell 73, 1–15.e1–e7, January 3, 2019 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER sgRNA targeting sequence: human OTUB2 (#2) CCGCTGAAAACAGGATTTAC This paper N/A sgRNA targeting sequence:mouse OTUB2 (#1) TGACTACTTTTGGGCCATGC This paper N/A sgRNA targeting sequence:mouse OTUB2 (#2) AGTGTTTCTCGGCTGCGTAA This paper N/A Recombinant DNA See Table S1 for the List for DUB cDNA library This paper N/A HA-SUMO1-3, SENPs and HA-PIAS1-3, Xa and Xb Zhang et al., 2017a; Zhang et al., cDNA Library Assay:Article Title: OTUB2 Promotes Cancer Metastasis via Hippo-Independent Activation of YAP and TAZ. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Human Insulin Sino Biological Cat# 11038-HNAY Dabrafenib Medchem Express Cat# HY-141660 LY3214996 Medchem Express Cat# HY-101494 Trametinib DMSO solvate Medchem Express Cat# HY-10999A Protease inhibitor cocktail Roche Cat# 04693159001 Phosphatase inhibitor cocktail Roche Cat# 04906837001 Critical Commercial Assays Dual-Luciferase Reporter Assay System Promega Cat# E1910 RevertAid First Strand cDNA Synthesis Kit Fermentas Cat# K1622 SYBR Green Master Mix Applied Biosystems Cat# A25742 StepOne Plus real-time PCR system Applied Biosystems Cat# 4376600 Duolink In Situ Detection Reagents Red Sigma-Aldrich Cat# DUO92008 Duolink In Situ PLA Probe Anti-Mouse PLUS Sigma-Aldrich Cat# DUO92001 Duolink In Situ PLA Probe Anti-Rabbit MINUS Sigma-Aldrich Cat# DUO92005 Deposited Data Raw imaging data This paper; Mendeley Data https://data.mendeley.com/datasets/h8jrmjjjbh/1 NKI295 dataset the Netherlands Cancer Institute http://ccb.nki.nl/data/ GSEA datasets Broad Institute http://software.broadinstitute.org/gsea/login. jsp;jsessionid=C2668366EB0BAA1232425637 E84322E2 Experimental Models: Cell Lines HEK293T, HEK293A, HeLa, 4T1, 4T07 and MDA-MB-231 cell lines ATCC Zhang et al., 2017b MCF10A (MI) and MCF10A-RAS (MII) cell lines Dr. Fred Miller, Barbara Ann Karmanos Cancer Institute, Detroit, USA N/A HEK293A LATS1/2 KO cells Dr. Kun-liang Guan, University of California San Diego, La Jolla, USA N/A Experimental Models: Organisms/Strains Mouse: Female BALB/c nude mice Model Animal Resource Information Platform, Nanjing, China N/A Mouse: Female syngeneic BALB/c mice Model Animal Resource Information Platform, Nanjing, China N/A Oligonucleotides See Table S6 for the List of Oligos for RT-qPCR This paper N/A shRNA targeting sequence: human OTUB2 (#1) Sigma-Aldrich TRCN0000230821 shRNA targeting sequence: human OTUB2 (#2) Sigma-Aldrich TRCN0000230819 shRNA targeting sequence: human YAP 30UTR Sigma-Aldrich TRCN0000300282 shRNA targeting sequence: human TAZ 30UTR Sigma-Aldrich TRCN0000019469 shRNA targeting sequence: mouse OTUB2 (#1) CCGGCTTCGGTTTATCTGCTCTATACTCGAGT ATAGAGCAGATAAACCGAAGTTTTTG This paper N/A shRNA targeting sequence: mouse OTUB2 (#2) CCGGCTATCCATTCTTCGGGATCATCTCGAGA TGATCCCGAAGAATGGATAGTTTTTG This paper N/A sgRNA targeting sequence: human OTUB2 (#1) CCGTGTCACATTTTTCTGAT This paper N/A (Continued on next page) Molecular Cell 73, 1–15.e1–e7, January 3, 2019 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER sgRNA targeting sequence: human OTUB2 (#2) CCGCTGAAAACAGGATTTAC This paper N/A sgRNA targeting sequence:mouse OTUB2 (#1) TGACTACTTTTGGGCCATGC This paper N/A sgRNA targeting sequence:mouse OTUB2 (#2) AGTGTTTCTCGGCTGCGTAA This paper N/A Recombinant DNA See Table S1 for the List for DUB cDNA library This paper N/A HA-SUMO1-3, SENPs and HA-PIAS1-3, Xa and Xb Zhang et al., 2017a; Zhang et al., Software:Article Title: OTUB2 Promotes Cancer Metastasis via Hippo-Independent Activation of YAP and TAZ. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Human Insulin Sino Biological Cat# 11038-HNAY Dabrafenib Medchem Express Cat# HY-141660 LY3214996 Medchem Express Cat# HY-101494 Trametinib DMSO solvate Medchem Express Cat# HY-10999A Protease inhibitor cocktail Roche Cat# 04693159001 Phosphatase inhibitor cocktail Roche Cat# 04906837001 Critical Commercial Assays Dual-Luciferase Reporter Assay System Promega Cat# E1910 RevertAid First Strand cDNA Synthesis Kit Fermentas Cat# K1622 SYBR Green Master Mix Applied Biosystems Cat# A25742 StepOne Plus real-time PCR system Applied Biosystems Cat# 4376600 Duolink In Situ Detection Reagents Red Sigma-Aldrich Cat# DUO92008 Duolink In Situ PLA Probe Anti-Mouse PLUS Sigma-Aldrich Cat# DUO92001 Duolink In Situ PLA Probe Anti-Rabbit MINUS Sigma-Aldrich Cat# DUO92005 Deposited Data Raw imaging data This paper; Mendeley Data https://data.mendeley.com/datasets/h8jrmjjjbh/1 NKI295 dataset the Netherlands Cancer Institute http://ccb.nki.nl/data/ GSEA datasets Broad Institute http://software.broadinstitute.org/gsea/login. jsp;jsessionid=C2668366EB0BAA1232425637 E84322E2 Experimental Models: Cell Lines HEK293T, HEK293A, HeLa, 4T1, 4T07 and MDA-MB-231 cell lines ATCC Zhang et al., 2017b MCF10A (MI) and MCF10A-RAS (MII) cell lines Dr. Fred Miller, Barbara Ann Karmanos Cancer Institute, Detroit, USA N/A HEK293A LATS1/2 KO cells Dr. Kun-liang Guan, University of California San Diego, La Jolla, USA N/A Experimental Models: Organisms/Strains Mouse: Female BALB/c nude mice Model Animal Resource Information Platform, Nanjing, China N/A Mouse: Female syngeneic BALB/c mice Model Animal Resource Information Platform, Nanjing, China N/A Oligonucleotides See Table S6 for the List of Oligos for RT-qPCR This paper N/A shRNA targeting sequence: human OTUB2 (#1) Sigma-Aldrich TRCN0000230821 shRNA targeting sequence: human OTUB2 (#2) Sigma-Aldrich TRCN0000230819 shRNA targeting sequence: human YAP 30UTR Sigma-Aldrich TRCN0000300282 shRNA targeting sequence: human TAZ 30UTR Sigma-Aldrich TRCN0000019469 shRNA targeting sequence: mouse OTUB2 (#1) CCGGCTTCGGTTTATCTGCTCTATACTCGAGT ATAGAGCAGATAAACCGAAGTTTTTG This paper N/A shRNA targeting sequence: mouse OTUB2 (#2) CCGGCTATCCATTCTTCGGGATCATCTCGAGA TGATCCCGAAGAATGGATAGTTTTTG This paper N/A sgRNA targeting sequence: human OTUB2 (#1) CCGTGTCACATTTTTCTGAT This paper N/A (Continued on next page) Molecular Cell 73, 1–15.e1–e7, January 3, 2019 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER sgRNA targeting sequence: human OTUB2 (#2) CCGCTGAAAACAGGATTTAC This paper N/A sgRNA targeting sequence:mouse OTUB2 (#1) TGACTACTTTTGGGCCATGC This paper N/A sgRNA targeting sequence:mouse OTUB2 (#2) AGTGTTTCTCGGCTGCGTAA This paper N/A Recombinant DNA See Table S1 for the List for DUB cDNA library This paper N/A HA-SUMO1-3, SENPs and HA-PIAS1-3, Xa and Xb Zhang et al., 2017a; Zhang et al., |